Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction

  • STATUS
    Recruiting
  • End date
    Oct 31, 2023
  • participants needed
    150
  • sponsor
    Karaganda Medical University
Updated on 22 March 2022
sepsis
cancer

Summary

Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs.

Today there are several methods for detecting BT:

  1. direct method - the detection of 16s rRNA (ribosomal ribonucleic acid) in mesenteric lymph nodes (MLN);
  2. indirect method - the detection of serum lipopolysaccharide-binding protein (LBP) and presepsin (Soluble CD14 subtype or sCD14-ST).

The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.

Description

For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications.

The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad.

The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC).

During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used.

This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597).

Details
Condition Intestinal Obstruction, Colorectal Cancer, Post-Op Complication, Systemic Inflammatory Response Syndrome, Colon Tumor
Treatment LBP, sCD14-ST, 16s rRNA, 16s rRNA
Clinical Study IdentifierNCT05229822
SponsorKaraganda Medical University
Last Modified on22 March 2022

Eligibility

Yes No Not Sure

Inclusion Criteria

patients with malignant acute bowel obstruction
patients with benign acute bowel obstruction
colorectal cancer patients without acute bowel obstruction (planned operations)

Exclusion Criteria

age less than 18
pregnancy
patients with paralytic acute bowel obstruction
patients with HIV infection, liver cirrhosis
patient with an infectious process due to another pathology
Clear my responses

How to participate?

Step 1 Connect with a study center
What happens next?
  • You can expect the study team to contact you via email or phone in the next few days.
  • Sign up as volunteer  to help accelerate the development of new treatments and to get notified about similar trials.

You are contacting

Investigator Avatar

Primary Contact

site

Additional screening procedures may be conducted by the study team before you can be confirmed eligible to participate.

Learn more

If you are confirmed eligible after full screening, you will be required to understand and sign the informed consent if you decide to enroll in the study. Once enrolled you may be asked to make scheduled visits over a period of time.

Learn more

Complete your scheduled study participation activities and then you are done. You may receive summary of study results if provided by the sponsor.

Learn more

Similar trials to consider

Loading...

Browse trials for

Not finding what you're looking for?

Every year hundreds of thousands of volunteers step forward to participate in research. Sign up as a volunteer and receive email notifications when clinical trials are posted in the medical category of interest to you.

Sign up as volunteer

user name

Added by • 

 • 

Private

Reply by • Private
Loading...

Lorem ipsum dolor sit amet consectetur, adipisicing elit. Ipsa vel nobis alias. Quae eveniet velit voluptate quo doloribus maxime et dicta in sequi, corporis quod. Ea, dolor eius? Dolore, vel!

  The passcode will expire in None.
Loading...

No annotations made yet

Add a private note
  • abc Select a piece of text from the left.
  • Add notes visible only to you.
  • Send it to people through a passcode protected link.
Add a private note